Skip to content

Advertisement

  • Research Paper
  • Open Access

Gene expression profiles of a mouse congenic strain carrying an obesity susceptibility QTL under obesigenic diets

  • 1,
  • 1, 4,
  • 2,
  • 1,
  • 3, 2 and
  • 1, 2, 4Email author
Genes & NutritionStudying the relationship between genetics and nutrition in the improvement of human health20095:163

https://doi.org/10.1007/s12263-009-0163-0

  • Received: 22 June 2009
  • Accepted: 24 November 2009
  • Published:

Abstract

Genetic factors are strongly involved in the development of obesity, likely through the interactions of susceptibility genes with obesigenic environments, such as high-fat, high-sucrose (HFS) diets. Previously, we have established a mouse congenic strain on C57BL/6 J background, carrying an obesity quantitative trait locus (QTL), tabw2, derived from obese diabetic TALLYHO/JngJ mice. The tabw2 congenic mice exhibit increased adiposity and hyperleptinemia, which becomes exacerbated upon feeding HFS diets. In this study, we conducted genome-wide gene expression profiling to evaluate differentially expressed genes between tabw2 and control mice fed HFS diets, which may lead to identification of candidate genes as well as insights into the mechanisms underlying obesity mediated by tabw2. Both tabw2 congenic mice and control mice were fed HFS diets for 10 weeks beginning at 4 weeks of age, and total RNA was isolated from liver and adipose tissue. Whole-genome microarray analysis was performed and verified by real-time quantitative RT–PCR. At False Discovery Rate adjusted P < 0.05, 1026 genes were up-regulated and 308 down-regulated in liver, whereas 393 were up-regulated and 187 down-regulated in adipose tissue in tabw2 congenic mice compared to controls. Within the tabw2 QTL interval, 70 genes exhibited differential expression in either liver or adipose tissue. A comprehensive pathway analysis revealed a number of biological pathways that may be perturbed in the diet-induced obesity mediated by tabw2.

Keywords

  • Gene expression profiles
  • QTL
  • Congenics
  • Diet-induced obesity
  • Mice

Introduction

The high prevalence of obesity in our society is currently overwhelming; approximately 1.2 billion people are overweight worldwide and among those at least 300 million people are obese [30]. The related medical complications are life-threatening diseases, including type 2 diabetes, heart disease, hypertension, and many forms of cancer [11]. The etiology of obesity is complex, involving genetic susceptibility, environmental influence, and gene-environmental interactions [23].

Animal models that share both physiologic and genetic similarity with humans have been used to minimize many difficulties encountered in carrying out obesity studies in humans [27]. Polygenic rodent models carrying natural variations have been developed and serve as valuable resources for obesity research, closely mimicking the polygenic inheritance of obesity in humans.

Previously, we have mapped a quantitative trait locus (QTL) linked to body weight on mouse chromosome 6 in a cross between C57BL/6J (B6) and obese diabetic TALLYHO/JngJ (TH) mice [9]. The TH allele was associated with higher body weights, and the QTL is named tabw2 (TALLYHO Associated Body Weight 2). Subsequently, we have constructed a congenic strain that carries a TH-derived genomic segment containing tabw2 on a B6 background. This congenic strain (tabw2 mice) exhibits increased adiposity and hyperleptinemia, and upon feeding high-fat, high-sucrose (HFS) diets, the obesity becomes exacerbated, followed by the development of insulin resistance [9].

The present study sought to investigate the genome-wide gene expression profiles in liver and adipose tissue to elucidate differentially expressed genes between tabw2 and control mice fed HFS diets. This study will identify differentially expressed genes within the congenic region, providing candidate genes for tabw2, as well as other genes involved in common pathways of obesity. The findings will contribute to understanding the gene networks underlying the diet-induced obesity mediated by tabw2.

Materials and methods

Animals and diets

The tabw2 congenic and control mice used in this study were from previously established lines [9]. Briefly, B6 female and TH male mice were crossed to yield F1 (or N1) progeny that were then backcrossed to B6 mice. The resulting N2 progeny were genotyped with flanking markers to select heterozygotes for the tabw2 QTL interval that were then again backcrossed to B6 mice. This procedure was repeated for 10 cycles of backcrossing to achieve more than 99% homogeneity [21] for the B6 genome in the congenic strain at which point two heterozygotes were intercrossed to yield offspring that were either homozygous for the TH alleles (tabw2 mice) or homozygous for the B6 alleles (control mice) (Fig. 1). Homozygous mice were then interbred to maintain the tabw2 and control mice.
Fig. 1
Fig. 1

Construction of a congenic mouse strain carrying the obesity QTL on chromosome 6, named tabw2, derived from TALLYHO/JngJ (TH) mice in the C57BL/6J (B6) background by marker assisted backcrossing. An obese TH male mouse was crossed to a normal B6 female mouse, and the resultant F1 (or N1) mice were backcrossed to B6. Heterozygotes for the QTL were selected using flanking markers (shown as dotted line) and backcrossed again to B6. This procedure was repeated for 10 cycles of backcrossing at which point two heterozygotes were intercrossed to yield offspring that are homozygous for the TH alleles (tabw2 mice) and for the B6 alleles (control mice) across the congenic region

All mice were allowed free access to food and water in a temperature and humidity controlled room with a 12-h light/dark cycle. Mice were weaned onto HFS diets (32% kcal from fat and 25% kcal from sucrose) (12266B, Research Diets, New Brunswick, NJ, USA) at 4 weeks of age. At 14 weeks of age, mice were weighed, then euthanized by CO2 asphyxiation, and liver and adipose tissue (inguinal, epididymal, retroperitoneal, perirenal, and subscapular fat pads) were collected, immediately frozen in liquid nitrogen, and stored at −80°C for RNA isolation. Statistical analysis for body weight data was conducted by ANOVA with StatView 5.0 (Abacus Concepts, Berkeley, CA). All animal studies were carried out with the approval of The University of Tennessee Animal Care and Use Committee.

RNA isolation

Total RNA was isolated from liver and white adipose (combined inguinal, epididymal, retroperitoneal, perirenal, and subscapular fat pads) tissue using RNeasy Lipid Tissue Midi Kit (75842, QIAGEN, Valencia, CA, USA) according to the manufacturer’s instructions. For adipose tissue, the entire tissue was homogenized and total RNA extracted, whereas approximately 50% of the liver was homogenized. Total RNA was further purified using RNeasy MinElute Cleanup Kit (74204, QIAGEN) for microarray analysis.

Microarray analysis

Hybridizations were performed at Genome Explorations Inc. (Memphis, TN, USA) using GeneChip® Mouse Genome 430 2.0 Array (Affymetrix, Santa Clara, CA, USA) following the standard protocol. The Mouse Genome 430 2.0 Array contains 45,000 probe sets on a single array to analyze the expression level of over 39,000 transcripts and variants from over 34,000 well-characterized mouse genes (Affymetrix). Total RNA isolated from liver and adipose tissue as described previously from 4 male tabw2 mice and 4 male control mice were used for microarray analysis, requiring 16 arrays.

The gcRMA (robust multi-array) process in Bioconductor (http://www.bioconductor.org) was used to produce a normalized signal measure for each gene on each array. Data were examined for outliers and consistency of arrays, then statistical analysis was performed using SAS software (SAS Institute Inc., Cary, NC, USA). A mixed ANOVA model [31] for each gene tested factorial treatment effects of genotype and tissue, and used array variation as the experimental error. Genes with significant (P < 0.05) ANOVA interaction and significant pair-wise False Discovery Rate [22] were considered differentially expressed. ANOVA results were used to create volcano plots to help visualize the distribution of differential expression.

Real-time quantitative RT–PCR

Total RNA (2 μg) was reverse-transcribed with SUPERSCRIPT RT (11904-018, Invitrogen, Carlsbad, CA, USA) using oligo d(T)12–18 (18418-012, Invitrogen) as primer to synthesize first-strand cDNA in 20-μl volume according to manufacturer’s instructions. Oligonucleotide primers were synthesized (Sigma–Aldrich, St. Louis, MO, USA) using sequences obtained from Primer Bank (http://pga.mgh.harvard.edu/primerbank) or the published literature (Table 1). The PCR reaction was carried out in a 25-μl volume in 1× SYBR Green PCR core reagents (PA-112, SABiosciences, Frederick, MD, USA) containing 1 μl cDNA template diluate (1:5, v/v) and 6 pmol primers. Real-time PCR was conducted using an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA). For each sample, triplicate amplifications were performed and the average measurements used for data analysis. The difference in average threshold cycle (∆Ct) values between 36B4 gene and a specific gene was calculated for each individual. The data were then presented as relative fold-change using control mice as the reference by equation 2−(∆Ct of tabw2 mice−∆Ct of control mice) [13]. If the difference was negative, the calculation was inverted and made negative, to signify over-expression in tabw2 mice. Mice measured by qRT–PCR were not the same as used in the microarray analysis to increase biological validation (n = 5, male, for each genotype).
Table 1

Primer sequences for real-time quantitative RT-PCR

Gene

Forward Primer (5′–3′)

Reverse Primer (5′−3′)

Reference

Acaa1a

TCTCCAGGACGTGAGGCTAAA

CGCTCAGAAATTGGGCGATG

Primer bank

Acaca

ATGGGCGGAATGGTCTCTTTC

TGGGGACCTTGTCTTCATCAT

Primer bank

Acss2

AAACACGCTCAGGGAAAATCA

ACCGTAGATGTATCCCCCAGG

Primer bank

Arhgdib

ATGACGGAGAAGGATGCACAG

CTCCCAGCAGTGTTTTCTTGTA

Primer bank

Ccnd2

GCGTGCAGAAGGACATCCA

CACTTTTGTTCCTCACAGACCTCTAG

[5]

Cyp4a14

TTTAGCCCTACAAGGTACTTGGA

GCAGCCACTGCCTTCGTAA

Primer bank

Daam1

AGATAGCGGATACCAAATCCAGT

TCTTCGCTTAGGTTGAGGACT

Primer bank

Hadhsc

TCAAGCATGTGACCGTCATCG

TGGATTTTGCCAGGATGTCTTC

Primer bank

Hsd17b4

AGGGGACTTCAAGGGAATTGG

GCCTGCTTCAACTGAATCGTAA

Primer bank

Klrd1

TCTAGGATCACTCGGTGGAGA

CACTTGTCCAGGCAAACACAG

Primer bank

Lrp6

TTGTTGCTTTATGCAAACAGACG

GTTCGTTTAATGGCTTCTTCGC

Primer bank

Mgll

CGGACTTCCAAGTTTTTGTCAGA

GCAGCCACTAGGATGGAGATG

Primer bank

Mup1

GAAGCTAGTTCTACGGGAAGGA

AGGCCAGGATAATAGTATGCCA

Primer bank

Nfatc3

ACTGCCTCATCACCATCTCC

TCCCAATAATCTCGTTCACATC

[20]

Nlk

ACCAAGATGATACCCTGTGACT

AAGAAGTTAGCCAGGAGGATCT

[19]

Ret

TTTCTCAAGGGATGCTTACTGGG

CCCGTAGGGCATGGACATAGA

Primer bank

Ruvbl1

AGCTGGGCAGTAAAGTCCCT

CCTCCCCTTCATAAACCTCCT

Primer bank

Sfrp5

CACTGCCACAAGTTCCCCC

TCTGTTCCATGAGGCCATCAG

Primer bank

Tcf3

ACGAGCTGATCCCCTTCCA

CAGGGACGACTTGACCTCAT

Primer bank

Tcf7l2

AACGAACACAGCGAATGTTTCC

CACCTTGTATGTAGCGAACGC

Primer bank

Wnt5b

CCAGTGCAGAGACCGGAGATG

GTTGTCCACGGTGCTGCAGTTC

[8]

36B4

GAGGAATCAGATGAGGATATGGGA

AAGCAGGCTGACTTGGTTGC

[3]

Results

Tabw2 mice fed HFS diets were significantly heavier than control mice [33.4 ± 1.2 (n = 14) vs. 28.0 ± 0.4 (n = 14) g; mean ± SEM; P = 0.0002; male; 14-week old].

Differentially expressed gene profiling overview in liver and adipose tissue from tabw2 and control mice

Using a global expression chip, we compared the levels of gene expression in liver and adipose tissue from tabw2 mice and control mice fed HFS diets. Gene expression profiles were visualized by volcano plots (Fig. 2). Overall, large differences in gene expression levels were rare between tabw2 and control mice, which can be deduced from the volcano plots clustered at the center. This may be because the only genomic difference between the tabw2 and control mice is in the congenic region.
Fig. 2
Fig. 2

Volcano plot comparison of gene expression between control (B) and tabw2 (T) mice in liver and adipose tissue. The X-axis indicates the differential expression, plotting the fold-difference ratios on a log-2 scale. The Y-axis indicates log10 statistical significance levels for difference in expression. Vertical reference lines indicate 2-fold expression change, and a horizontal reference line is drawn at P < 0.05

Of over 39,000 transcripts (hereafter referred to as genes), at a significance level of P < 0.05, 1026 genes were up-regulated and 308 down-regulated in liver, whereas 393 were up-regulated and 187 down-regulated in adipose tissue in tabw2 mice compared to control mice. When examined in each tissue for the top 50 (25 up-regulated and 25 down-regulated) genes with the largest effect of genotype (Tables 2 and 3), the most largely changed genes were found in adipose tissue; Sfrp5 (up-regulated in tabw2 mice) and Mup1 (down-regulated in tabw2 mice) (Table 2).
Table 2

The 50 genes with largest fold change between tabw2 and control mice in adipose tissue

Probe set ID

Symbol

Gene name

Chr

Fold

Up-regulated in tabw2

 1436075_at

Sfrp5

Secreted frizzled-related sequence protein 5

19

8.59

 1436294_at

Ankrd29

Ankyrin repeat domain 29

18

6.14

 1418713_at

Pcbdl

Pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nu

10

6.02

 1430596_s_at

1700110N18Rik

RIKEN cDNA 1700110N18 gene

16

5.97

 1419109_at

Hrc

Histidine rich calcium binding protein

7

5.57

 1441737_s_at

Rassf1

Ras association (RalGDS/AF-6) domain family 1

9

5.04

 1438967_x_at

Amhr2

Anti-Mullerian hormone type 2 receptor

15

4.55

 1426143_at

Trdn

Triadin

10

4.00

 1447851_x_at

Atp10a

ATPase, class V, type 10A

7

3.98

 1455215_at

C530028O21Rik

RIKEN cDNA C530028O21 gene

6

3.92

 1418497_at

Fgf13

Fibroblast growth factor 13

X

3.84

 1422580_at

Myl4

Myosin, light polypeptide 4

11

3.82

 1435631_x_at

Exoc6

Exocyst complex component 6

19

3.66

 1444089_at

Spnb2

Spectrin beta 2

11

3.58

 1436359_at

Ret

Ret proto-oncogene

6

3.46

 1448595_a_at

Rex3

Reduced expression 3

X

3.35

 1429135_at

1110059M19Rik

RIKEN cDNA 1110059M19 gene

X

3.31

 1447657_s_at

Synpo2 l

Synaptopodin 2-like

14

3.24

 1429599_a_at

1110019K23Rik

RIKEN cDNA 1110019K23 gene

5

3.19

 1460010_a_at

Ptdss2

Phosphatidylserine synthase 2

7

3.15

 1457021_x_at

Amhr2

Anti-Mullerian hormone type 2 receptor

15

3.10

 1434797_at

6720469N11Rik

RIKEN cDNA 6720469N11 gene

3

3.07

 1420143_at

Mnab

Membrane associated DNA binding protein

2

3.06

 1447520_at

Lbp

Lipopolysaccharide binding protein

2

3.05

 1435917_at

Ociad2

OCIA domain containing 2

5

3.05

Down-regulated in tabw2

 1434110_x_at

Mup1

Major urinary protein 1

4

7.74

 1448229_s_at

Ccnd2

Cyclin D2

6

4.67

 1454169_a_at

Epsti1

Epithelial stromal interaction 1 (breast)

14

4.47

 1422479_at

Acss2

Acyl-CoA synthetase short-chain family member 2

2

4.46

 1419480_at

Sell

Selectin, lymphocyte

1

3.70

 1426806_at

5830411E10Rik

RIKEN cDNA 5830411E10 gene

1

3.49

 1447147_at

Apg7 l

Autophagy-related 7 (yeast)

6

3.46

 1424825_a_at

Glycam1

Glycosylation dependent cell adhesion molecule 1

15

3.46

 1460245_at

Klrd1

Killer cell lectin-like receptor, subfamily D, member 1

6

3.39

 1426166_at

Mup5

Major urinary protein 5

4

3.34

 1435602_at

Sephs2

Selenophosphate synthetase 2

7

3.34

 1418126_at

Ccl5

Chemokine (C–C motif) ligand 5

11

3.24

 1424931_s_at

Igl-V1

Immunoglobulin lambda chain, variable 1

16

3.20

 1436766_at

Luc7l2

LUC7-like 2 (S. cerevisiae)

6

3.13

 1423371_at

Pole4

Polymerase (DNA-directed), epsilon 4 (p12 subunit)

6

3.11

 1451335_at

Plac8

Placenta-specific 8

5

3.09

 1460521_a_at

5830411E10Rik

RIKEN cDNA 5830411E10 gene

1

3.07

 1422411_s_at

Ear1

Eosinophil-associated, ribonuclease A family, member 1

14

2.87

 1425137_a_at

H2-Q10

Histocompatibility 2, Q region locus 10

17

2.81

 1437636_at

LOC623121

Similar to Interferon-activatable protein 203 (Ifi-203) (Interferon-inducible protein p203)

1

2.77

 1451644_a_at

H2-Q1

Histocompatibility 2, Q region locus 1

17

2.77

 1433827_at

Atp8a1

ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1

5

2.76

 1451691_at

Ednra

Endothelin receptor type A

8

2.66

 1434152_at

2210421G13Rik

RIKEN cDNA 2210421G13 gene

15

2.64

 1426159_x_at

Tcrb-V13

T-cell receptor beta, variable 13

6

2.61

Chr chromosome

Table 3

The 50 genes with largest fold change between tabw2 and control mice in liver

Probe set ID

Symbol

Gene name

Chr

Fold

Up-regulated in tabw2

 1444438_at

Cib3

Calcium and integrin binding family member 3

8

4.89

 1423257_at

Cyp4a14

Cytochrome P450, family 4, subfamily a, polypeptide 14

4

3.75

 1455308_at

Tmem16f

Transmembrane protein 16F

15

3.02

 1453462_at

Chst13

Carbohydrate (chondroitin 4) sulfotransferase 13

6

2.92

 1452005_at

Dlat

Dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)

9

2.89

 1437239_x_at

Phc2

Polyhomeotic-like 2 (Drosophila)

4

2.77

 1449641_at

Adk

Adenosine kinase

14

2.75

 1422076_at

Acot4

Acyl-CoA thioesterase 4

12

2.68

 1447227_at

Slc40a1

Solute carrier family 40 (iron-regulated transporter), member 1

1

2.61

 1438969_x_at

Dhx30

DEAH (Asp-Glu-Ala-His) box polypeptide 30

9

2.56

 1449770_x_at

Tmem191c

Transmembrane protein 191C

16

2.56

 1438617_at

Serpina7

Serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7

X

2.53

 1420357_s_at

Xlr3a

X-linked lymphocyte-regulated 3A

X

2.52

 1431805_a_at

Rhpn2

Rhophilin, Rho GTPase binding protein 2

7

2.46

 1417280_at

Slc17a1

Solute carrier family 17 (sodium phosphate), member 1

13

2.45

 1438660_at

Gcnt2

Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme

13

2.45

 1451822_a_at

Scrn2

Secernin 2

11

2.45

 1418524_at

Pcm1

Pericentriolar material 1

8

2.43

 1438487_s_at

Zzz3

Zinc finger, ZZ domain containing 3

3

2.42

 1448385_at

Slc15a4

Solute carrier family 15, member 4

5

2.41

 1437983_at

Sall1

Sal-like 1 (Drosophila)

8

2.37

 1422077_at

Acot4

Acyl-CoA thioesterase 4

12

2.35

 1441141_at

Amn1

Antagonist of mitotic exit network 1 homolog (S. cerevisiae)

6

2.33

 1426350_at

Mgat2

Mannoside acetylglucosaminyltransferase 2

12

2.32

 1444810_at

Acaca

Acetyl-Coenzyme A carboxylase alpha

11

2.29

Down-regulated in tabw2

 1421447_at

Onecut1

One cut domain, family member 1

9

3.57

 1452431_s_at

H2-Aa

Histocompatibility 2, class II antigen A, alpha

17

3.43

 1453007_at

3110082I17Rik

RIKEN cDNA 3110082I17 gene

5

2.67

 1421571_a_at

Ly6c

Lymphocyte antigen 6 complex, locus C

15

2.62

 1457619_at

BC015286

cDNA sequence BC015286

8

2.44

 1417025_at

H2-Eb1

Histocompatibility 2, class II antigen E beta

17

2.38

 1456524_at

Nrg1

Neuregulin 1

8

2.37

 1439256_x_at

Tm 7sf1

Transmembrane 7 superfamily member 1

13

2.36

 1422754_at

Tmod1

Tropomodulin 1

4

2.33

 1424186_at

2610001E17Rik

RIKEN cDNA 2610001E17 gene

16

2.28

 1447870_x_at

1110002E22Rik

RIKEN cDNA 1110002E22 gene

3

2.25

 1450839_at

D0H4S114

DNA segment, human D4S114

18

2.17

 1432620_at

Ttn

Titin

2

2.05

 1428549_at

Ccdc3

Coiled-coil domain containing 3

2

1.98

 1425167_a_at

Gngt1

Guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1

6

1.97

 1455307_at

BC037112

cDNA sequence BC037112

5

1.97

 1423028_at

Ifna2

Interferon alpha family, gene 2

4

1.92

 1421226_at

Trem2

Triggering receptor expressed on myeloid cells 2

17

1.85

 1425358_at

Riok1

RIO kinase 1 (yeast)

13

1.85

 1457023_at

5830411G16Rik

RIKEN cDNA 5830411G16 gene

6

1.83

 1427048_at

Smo

Smoothened homolog (Drosophila)

6

1.81

 1450068_at

Baz1b

Bromodomain adjacent to zinc finger domain, 1B

5

1.80

 1429144_at

Prei4

Preimplantation protein 4

2

1.80

 1456093_at

Zfp536

Zinc finger protein 536

7

1.77

 1450843_a_at

Serpinh1

Serine (or cysteine) peptidase inhibitor, clade H, member 1

7

1.73

Chr chromosome

Differentially expressed genes located within the tabw2 QTL interval

Using congenic mice, the microarray analysis strategy has been useful in identification of QTLs [1, 28]. In an attempt to select attractive positional candidate genes for tabw2, we examined the gene expression levels located within the tabw2 congenic interval on chromosome 6, based on the hypothesis that the genetic alteration of tabw2 may cause dysregulation of the gene expression. Forty-five genes in liver and 32 genes in adipose tissue located within the congenic interval (47.0–137.3 Mb) were differentially expressed between tabw2 and control mice (Table 4); 7 genes, including Znrf2, Pole4, Isy1, Frmd4b, Tmcc1, Ccnd2, and Lrp6, appeared in both tissues. Of these 70 genes, seven (5830411G16Rik and Chast13 in liver and Pole4, Ret, C530028O21Rik, Ccnd2, and Klrd1 in adipose tissue) were present in the top 50 genes with the largest fold change between tabw2 and control mice (boldface entries Table 4).
Table 4

Differentially expressed genes between tabw2 and control mice in liver and adipose tissue (fat) that are located within the congenic interval on chromosome 6

Probe set ID

Symbol

Gene name

Mb

Tissue

Fold

1441727_s_at

Zfp467

Zinc finger protein 467

48.4

Fat

−1.85

1434043_a_at

Repinl

Replication initiator 1

48.5

Fat

−1.73

1424375_s_at

Gimap4

GTPase, IMAP family member 4

48.6

Fat

1.64

1420365_a_at

Hnrpa2b1

Heterogeneous nuclear ribonucleoprotein A2/B1

51.4

Liver

−1.16

1428922_at

1200009O22Rik

RIKEN cDNA 1200009O22 gene

53.8

Fat

−2.20

1434016_at

Znrf2

Zinc and ring finger 2

54.8

Fat

1.77

1444735_at

   

Liver

−1.28

1423784_at

Gars

Glycyl-tRNA synthetase

55.0

Liver

−1.26

1418697_at

Inmt

Indolethylamine N-methyltransferase

55.1

Fat

2.26

1418656_at

Lsm5

LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)

56.7

Liver

−1.23

1457023_at

5830411G16Rik

Riken cDNA 5830411G16 gene

56.7

Liver

1.83

1432026_a_at

Herc5

Hect domain and RLD 5

57.4

Liver

1.32

1429194_at

Tigd2

Tigger transposable element derived 2

59.2

Liver

−1.41

1449519_at

Gadd45a

Growth arrest and DNA-damage-inducible 45 alpha

67.0

Liver

−1.74

1427860_at

LOC100047162

Similar to Ig kappa chain V–V region MPC11 precursor

70.4

Fat

1.54

1425335_at

Cd8a

CD8 antigen, alpha chain

71.3

Fat

1.96

1443830_x_at

Rnf103

Ring finger protein 103

71.5

Liver

−1.39

1420289_at

T25656

Expressed sequence T25656

71.6

Liver

1.11

1424716_at

Restsat

Retinol saturase (all trans retinol 13, 14 reductase)

72.5

Liver

−1.58

1450117_at

Tcf3

Transcription factor 3

72.6

Fat

−1.64

1448895_a_at

Ctnna2

Catenin (cadherin associated protein), alpha 2

76.8

Liver

1.38

1432286_at

Pole4

Polymerase (DNA-directed), epsilon 4 (p12 subunit)

82.6

Liver

1.26

1423371_at

   

Fat

3.11

1436618_at

Sfxn5

Sideroflexin 5

85.2

Liver

−1.67

1432969_at

4933423K11Rik

RIKEN cDNA 4933423K11 gene

85.3

Liver

1.09

1418013_at

Cml1

Camello-like 1

85.9

Fat

−1.51

1447277_s_at

Pcyox1

Prenylcysteine oxidase 1

86.3

Liver

−1.27

1418229_s_at

Nfu1

NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)

87.0

Liver

−1.32

1453132_a_at

Gkn2

Gastrokine2

87.3

Liver

1.38

1459728_at

Isy1

ISY1 splicing factor homolog (S. cerevisiae)

87.8

Fat

−2.46

    

Liver

−1.35

1416244_a_at

Cnbp

Cellular nucleic acid binding protein

87.8

Liver

−1.17

1416585_at

Ruvbl1

RuvB-like protein 1

88.4

Liver

−1.30

1442560_at

Mgll

Monoglyceride lipase

88.7

Liver

−2.01

1453462_at

Chst13

Carbohydrate (chondroitin 4) sulfotransferase 13

90.3

Liver

−2.92

1451229_at

Hdac11

Histone deacetylase 11

91.1

Liver

−1.27

1456879_at

C130022K22Rik

RIKEN cDNA C130022K22 gene

91.8

Liver

−1.50

1416911_a_at

6330407G11Rik

RIKEN cDNA 6330407G11 gene

92.0

Liver

−2.10

1449194_at

Mrps25

Mitochondrial ribosomal protein S25

92.1

Liver

−1.24

1439933_at

B430316J06Rik

RIKEN cDNA B430316J06 gene

93.9

Liver

−1.74

1443231_at

AW544 786

Expressed sequence tag

94.2

Fat

−2.22

1433671_at

A130022J15Rik

RIKEN cDNA A130022J15 gene

97.1

Liver

1.49

1452123_s_at

Frmd4b

FERM domain containing 4B

97.2

Liver

−1.83

1426594_at

   

Fat

1.34

1421111_at

Rybp

RING1 and YY1 binding protein

100.1

Liver

1.18

1428137_at

Arl8b

ADP-ribosylation factor-like 8b

108.7

Liver

−1.50

1443954_at

Rad18

RAD18 homolog (S. cerevisiae)

112.6

Fat

1.27

1423189_at

6720456B07Rik

RIKEN cDNA 6720456B07 gene

113.5

Liver

−1.37

1444806_at

AK054191

Expressed sequence tag

113.5

Fat

1.98

1447147_at

AI747732

Expressed sequence tag

114.8

Fat

3.46

1440028_at

4631423B10Rik

RIKEN cDNA 4631423B10 gene

114.8

Fat

−1.70

1437677_at

AI449595

Expressed sequence tag

114.9

Liver

1.11

1416078_s_at

Rafl

v-Raf-1 leukemia viral oncogene 1

115.5

Liver

−1.37

1440384_at

Tmccl

Transmembrane and coiled-coil domains 1

115.9

Liver

−1.94

    

Fat

−1.88

1417574_at

Cxcl12

Chemokine (C-X-C motif) ligand 12

117.1

Fat

2.25

1436359_at

Ret

Ret proto-oncogene

118.1

Fat

−3.46

1422602_a_at

Wnt5b

Wingless-related MMTV integration site 5B

119.3

Liver

1.19

1417407_at

Fbxl14

F-box and leucine-rich repeat protein 14

119.4

Liver

−1.50

1424247_at

Ercl

ELKS/RAB6-interacting/CAST family member 1

119.5

Fat

−1.71

1434221_at

BC030863

cDNA sequence BC030863

120.8

Liver

−1.20

1425951_a_at

Clec4n

C-type lectin domain family 4, member n

123.1

Fat

1.68

1426770_at

Pex5

Peroxisome biogenesis factor 5

124.3

Liver

−1.33

1422106_a_at

Spsb2

SplA/ryanodine receptor domain and SOCS box containing 2

124.7

Fat

−1.12

1455215_at

C530028O21Rik

RIKEN cDNA C530028O21 gene

124.9

Fat

−3.92

1455785_at

Kcnal

Potassium voltage-gated channel, shaker-related subfamily, member 1

126.5

Fat

1.26

1448229_s_at

Ccnd2

Cyclin D2

127.0

Fat

4.67

1434745_at

   

Liver

−1.69

1460245_at

Klrdl

Killer cell lectin-like receptor, subfamily D, member 1

129.5

Fat

3.39

1446155_at

AK078025

Expressed sequence tag

133.0

Fat

2.32

1415968_a_at

Kap

Kidney androgen-regulated protein

133.7

Fat

−2.87

1440982_at

BB209400

Expressed sequence tag

134.0

Fat

−1.23

1451022_at

Lrp6

Low density lipoprotein receptor-related protein 6

134.4

Fat

−1.92

    

Liver

−1.29

1435085_at

Crebl2

CAMP responsive element binding protein-like 2

134.8

Liver

−1.39

1434045_at

Cdkn1b

Cyclin-dependent kinase inhibitor 1B

134.8

Liver

−1.89

1426454_at

Arhgdib

Rho, GDP dissociation inhibitor (GDI) beta

136.8

Liver

1.58

Genes in bold are present in the top 50 genes with the largest fold change between tabw2 and control mice

Mb, mega-base; ‘−’ indicates up-regulation and ‘no sign’ indicates down-regulation in tabw2 mice compared to control mice

Except for a few genes, such as Mgll, the differentially expressed genes within the congenic interval had mostly unknown connections with obesity. Monoglyceride lipase (Mgll) hydrolyzes the monoglycerides formed during the hydrolysis of triglycerides [24]. The gene expression of Mgll was increased in liver of tabw2 mice. In agreement with this, hepatic increases in protein and activity of Mgll have previously been reported in obese mice fed high-fat diets, whereas little changes in adipose tissue occurred [2].

Another interesting finding was the down-regulation of Arhgdib gene in liver of tabw2 mice. ARHGDIB (also known as Rho GDIβ or D4/Ly GDI) negatively regulates Rho small GTP-binding protein by inhibiting dissociation of GDP from Rho protein. The Arhgdib gene is usually largely expressed in hematopoietic cells and known to be involved in immune response regulation [12, 32]. In the context of immune functions, a significant decrease in the expression of the Klrd1 gene was also exhibited in adipose tissue of tabw2 mice. KLRD1 (also known as CD94) associates with a member of the NKG2 family and regulates natural killer cell functions [6].

Biochemical pathways differentially regulated in tabw2 and control mice

In order to elucidate a biochemical differentiation between tabw2 and control mice, we conducted a pathway analysis. All the differentially expressed genes were examined for known pathway networks using the Database for Annotation, Visualization, and Integration Discovery Bioinformatics Resources 2008 (DAVID) Functional Annotation Tool (http://david.abcc.ncifcrf.gov/). Through the biochemical pathways of the Kyoto Encyclopedia of Genes and Genomes (KEGG), 70 genes were assigned to 13 known pathways in liver, whereas 32 genes were assigned to 9 known pathways in adipose tissue with Expression Analysis Systematic Explorer (EASE) threshold of 0.1 and a minimum of 2 genes present for the corresponding pathway (Table 5).
Table 5

Biological pathways associated with differentially expressed genes between tabw2 and control mice through KEGG pathway using DAVID

Term

KEGG ID

Count

EASE score

Gene

Adipose tissue

 ErbB signaling pathway

mmu04012

10

0.0038

Gabl, Akt3, Mapk9, Camk2g, Pak4, Bad, Cdknla, Map2k7, Gsk3b, Camk2d

 Pyruvate metabolism

mmu00620

6

0.016

Acaca, Akr1b3, Acat2, Acacb, Dlat, Acss2

 Propanoate metabolism

mmu00640

5

0.022

Acaca, Acat2, Acacb, Mut, Acss2

 Prostate cancer

mmu05215

8

0.038

Tcf3 , Igf1, Akt3, Igflr, Bad, Cdkn1a, Pdgfc, Gsk3b

 Melanoma

mmu05218

7

0.041

Igf1, Akt3, Igflr, Bad, Fgf13, Cdknla, Pdgfc

 Glioma

mmu05214

6

0.074

Igfl, Akt3, Igf1r, Camk2g, Cdkn1a, Camk2d

 Olfactory transduction

mmu04740

4

0.080

Clca1, Clca2, Camk2g, Camk2d

 Wnt signaling pathway

mmu04310

10

0.082

Tcf3 , Ccnd2 , Mapk9, Camk2g, Nfatc3, Daaml, Lrp6 , Sfrp5, Gsk3b, Camk2d

 Focal adhesion

mmu04510

12

0.090

Itgal, Thbsl, Igfl, Akt3, Ccnd2, Igflr, Mapk9, Pak4, Bad, Pdgfc, Itgb5, Gsk3b

Liver

 Long-term potentiation

mmu04720

10

0.019

Camk2b, Ppp3c, Rps6ka2, Gnaq, Rafl , Prkacb, Ppplrl2a, Braf Itpr2, Crebbp

 Fatty acid metabolism

mmu00071

8

0.019

Gcdh, Cyp4al0, Hsdl7b4, Ehhadh, Acaala, Cyp4al4, Acaalb, Hadh

 Wnt signaling pathway

mmu04310

17

0.025

Nlk, Camk2b, Ppp3ca, Mapk8, Prkacb, MapklO, Ccnd2 , Tcf7l2, Lrp6 , Fzd7, Wnt5b , Csnk2a2, Mmp7, Ruvbll, Nfatc3, Nfat5, Crebbp

 Caprolactam degradation

mmu00930

4

0.038

Sirt5, Hsdl 7b4, Ehhadh, Hadh

 Fatty acid biosynthesis

mmu00061

3

0.053

Oxsm, Acaca, Mcat

 Geraniol degradation

mmu00281

3

0.053

Hsdl7b4, Acaalb, Hadh

 Prostate cancer

mmu05215

11

0.054

Creb3l2, Igfl, Raf1 , Chuk, Cdknlb, Sos2, Braf, Pten, Nfkbl, Tcf7l2, Crebbp

 Lysine degradation

mmu00310

7

0.057

Gcdh, Ogdh, Hsdl 7b4, Ehhadh, Aadat, Hadh, Aass

 Gap junction

mmu04540

11

0.065

Gnaq, Raf1 , Prkacb, Sos2, Tubb2a, Itpr2, Gjal, Prkgl, Htr2b, Tubb2b, Gnai3

 Acute myeloid leukemia

mmu05221

8

0.074

Sfpil, Raf1 , Chuk, Sos2, Braf, Nfkbl, Tcf7l2, Rps6kbl

 Melanogenesis

mmu04916

11

0.087

Camk2b, Ednrb, Creb3l2, Gnaq, Raf1 , Prkacb, Tcf7l2, Fzd7, Wnt5b , Crebbp, Gnai3

 MAPK signaling pathway

mmu04010

23

0.092

Map3kl, Nlk, Gadd45a, Ppp3ca, Mapk8, Raf1 , Sos2, MapklO, Prkacb, Chuk, Braf, Cacnb3, Stk4, Elk4, Rps6ka2, Dusp3, Cdl4, Rasal, Mapkl2, Nfkbl, Rapgef2, Map3k7ip2, Fgfr3

 Citrate cycle (TCA cycle)

mmu00020

5

0.094

Pcx, Ogdh, Sdhd, Idh3a, Aco1

Genes in bold are in the congenic interval

DAVID, Database for Annotation, Visualization and Integration Discovery Bioinformatics Resources 2008 (http://david.abcc.ncifcrf.gov/); KEGG, Kyoto Encyclopedia of Genes and Genomes; Term, enriched terms (pathways) associated with the gene list; Count, the number of genes involved in the term; EASE (Expression Analysis Systematic Explorer) score, Modified Fisher Exact P-value (smaller means more enriched)

While only 6 genes included in the pathways (boldface entries) were located within the tabw2 congenic region, five (Tcf3, Ccnd2, Lrp6, Wnt5b, and Ruvbl1) out of the 6 genes were involved in the Wnt signaling pathway in either liver or adipose tissue.

Multiple genes were present in pathways associated with intermediary metabolism. These include genes required for fatty acid oxidation, such as Hadhsc (mitochondrial β-oxidation), Acaa1a and Hsd17b4 (peroxisomal β-oxidation), and Cyp4a14 (microsomal ω-oxidation) and lipogenic enzymes, such as Acss2 and Acaca. Acyl-CoA synthetase short-chain family member 2 (Acss2) catalyzes the production of acetyl-CoA from CoA and acetate, producing a key molecule in multiple metabolic pathways [14, 26]. Acetyl-CoA carboxylase alpha (Acaca) catalyzes the carboxylation of acetyl-CoA to produce malonyl-CoA that is used as a building block in the de novo long-chain fatty acid synthesis [29].

Microarray validation by real-time qRT–PCR

Changes of gene expression elucidated by microarray analysis were further verified with selected genes by real-time qRT-PCR. We chose to validate 21 genes of interest from the list of genes found in the top 50 genes with the largest effect of genotype, located on the tabw2 interval, or involved in Wnt signaling or intermediary metabolism (Table 6). The qRT-PCR results from the 21 selected genes showed close agreement with microarray fold-changes (r = 0.81, P < 0.001). Few genes including Ccnd2, Lrp6, and Nfatc3 in adipose tissue and Ruvbl1 and Nlk in liver were outside the qRT-PCR confidence interval.
Table 6

Microarray vs. real-time quantitative RT-PCR (qRT-PCR) for selected genes in liver and adipose tissue (fat) from tabw2 and control mice

 

Microarray

qRT-PCR

Probe set ID

Symbol

Gene name

Tissue

Fold

Fold (CI)

1416946_a_at

Acaala

Acetyl-Coenzyme A acyltransferase 1A

Liver

−1.32

−1.08 (−3.08, 2.60)

1434185_at

Acaca

Acetyl-Coenzyme A carboxylase alpha

Fat

2.03

3.21 (−1.19, 12.34)

1422479_at

Acss2

Acyl-CoA synthetase short-chain family member 2

Fat

4.46

2.35 (1.19, 4.66)

1426454_at

Arhgdib

Rho, GDP dissociation inhibitor (GDI) beta

Liver

1.58

1.42 (−2.60, 4.21)

   

Fat

 

1.43 (1.05, 2.17)

1448229_s_at

Ccnd2

Cyclin D2

Liver

−1.69

−1.71 (−9.33, 3.18)

1434745_at

  

Fat

4.67

1.04 (−1.40, 1.52)

1423257_at

Cyp4a14

Cytochrome P450, family 4, subfamily a, polypeptide 14

Liver

−3.75

−1.15 (−61.22, 46.19)

1431035_at

Daaml

Dishevelled associated activator of morphogenesis 1

Fat

−1.38

−1.27 (−1.80, 1.10)

1436756_x_at

Hadhsc

L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain

Liver

−1.54

−1.36 (−2.06, 1.11)

1455777_x_at

Hsd17b4

Hydroxysteroid (17-beta) dehydrogenase 4

Liver

−1.29

−1.06 (−2.04, 1.80)

1460245_at

Klrdl

Killer cell lectin-like receptor, subfamily D, member 1

Fat

3.39

6.22 (2.97, 13.03)

1451022_at

Lrp6

Low density lipoprotein receptor-related protein 6

Liver

−1.29

−1.06 (−2.60, 2.31)

   

Fat

−1.92

1.70 (−1.09, 3.19)

1442560_at

Mgll

Monoglyceride lipase

Liver

−2.01

−3.63 (−14.2, 1.07)

1434110_x_at

Mup1

Major urinary protein 1

Fat

7.74

5.44 (2.40, 12.29)

1419976_s_at

Nfatc3

Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3

Liver

−1.50

−1.05 (−2.89, 2.62)

   

Fat

−1.52

−1.03 (−1.30, 1.21)

1419112_at

Nlk

Nemo like kinase

Liver

−1.53

−1.13 (−1.50, 1.15)

1436359_at

Ret

Ret proto-oncogene

Fat

−3.46

−4.16 (−13.91, −1.24)

1416585_at

Ruvbl1

RuvB-like protein 1

Liver

−1.30

1.59 (−1.16, 2.97)

1436075_at

Sfrp5

Secreted frizzled-related sequence protein 5

Fat

−8.59

−3.98 (−13.07, −1.21)

1450117_at

Tcf3

Transcription factor 3

Fat

−1.64

1.04 (−2.05, 2.23)

1429428_at

Tcf7l2

Transcription factor 7-like 2, T-cell specific, HMG-box

Liver

−1.33

−1.59 (−3.39, 1.33)

1422602_a_at

Wnt5b

Wingless-related MMTV integration site 5B

Liver

1.19

1.01 (−3.63, 3.75)

   

Fat

 

2.56 (1.04, 6.85)

‘−’ indicates up-regulation and ‘no sign’ indicates down-regulation in tabw2 mice compared to control mice; CI=95%, confidence interval (lower limit, upper limit)

Discussion

We applied oligonucleotide microarray analysis accompanied by real-time qRT-PCR to evaluate changes in gene expression in diet-induced obesity mediated by tabw2 QTL. By using the tabw2 congenic mice and control mice fed a HFS diet, we were able to elucidate gene networks that may be perturbed by tabw2.

Emerging evidence indicates that Wnt signaling is involved in adipogenesis, as well as in glucose and lipid metabolism [18]. In our study, we detected changes in gene expression of a Wnt member, Wnt5b, and several regulators and effectors of Wnt signaling, including Sfrp5 that prevents Wnts binding to frizzed receptors, in tabw2 mice. A large increase in gene expression levels of Sfrp5 was also previously reported in diet-induced obesity in mice [10]. Recently, the WNT5B gene has been reported to be associated with risk of type 2 diabetes in the Japanese populations [8] and Caucasian subjects [25].

Obesity is often concomitant with alterations in the rhythmic regulations of biological systems. For example, blunted diurnal variations and dampened ultradian pulsatility of circulating hormones, such as leptin and ghrelin, were observed in obese humans [7]. Gene expression of Mup, the lipocalin family, is regulated in liver by a pulsatile stimulus of growth hormone [16]. Interestingly, decreased MUP levels in urine were exhibited in obese mice [15]. Although the role of MUP in adipose tissue is unknown, we speculate that the significant decrease of the Mup1 gene expression in adipose tissue of tabw2 mice (Table 2) might reflect alterations in endocrine rhythmicity in these mice.

Given that fat mass is significantly increased in tabw2 mice, it was surprising to observe that expression of genes involved in fatty acid oxidation systems (Acaa1a, Cyp4a14, Hadhsc, and Hsd17b4) was up-regulated in liver, and expression of lipogenic genes (Acss2 and Acaca) was down-regulated in adipose tissue of tabw2 mice (Table 6). A decreased expression of lipogenic genes in adipose tissue was previously reported in obese human subjects [4, 17]. A possible reason for the paradoxical findings is that the decreased expression of lipogenic genes reflects a late and adaptive process; i. e., when the adipose tissue was sampled, the subjects were at a late stage of obesity and no longer expanding fat mass [4]. Observations in the present study do not rule out the possibility of an increase in lipogenic gene expression in adipose tissue at younger ages when the process of fat storing might be more rapid and dynamic than at 14 weeks of age.

Seventy of the differentially expressed genes were located within the congenic interval, which provides the possibility that a polymorphism/mutation in one of these genes could be responsible for the obesity phenotype attributed to tabw2. Our microarray data will assist candidate gene selections when the tabw2 interval is fine mapped.

In summary, we have provided a genome-wide overview of changes in gene expression that may contribute to diet-induced obesity mediated by tabw2. Our genomic profiling increased our understanding of dysregulated biological systems in tabw2 mice that will lead to targeted metabolic and molecular studies. These data may contribute to understanding the mechanisms of gene-by-diet interactions in the development of obesity, which potentially provides insights into mechanisms for human obesity.

Declarations

Acknowledgments

This work was supported in part by American Heart Association Grants 0235345 N and 0855300E, NIH/National Institute of Diabetes and Digestive and Kidney Disease Grant 1R01DK077202-01A2, funding from the Center of Genomics and Bioinformatics, and a pilot and feasibility grant from the University of Tennessee Obesity Research Center to J.H.Kim.

Conflict of interest statement

Authors declare not to have any conflict of interest.

Authors’ Affiliations

(1)
Department of Nutrition, The University of Tennessee, Knoxville, TN 37996, USA
(2)
Genome Science and Technology Program, The University of Tennessee, Knoxville, TN 37996, USA
(3)
Department of Animal Science, The University of Tennessee, Knoxville, TN 37996, USA
(4)
Department of Pharmacology, Physiology and Toxicology, Joan C. Edwards School of Medicine, Marshall University, 1700 3rd Ave., Huntington, WV 25755, USA

References

  1. Aitman TJ, Glazier AM, Wallace CA, Cooper LD, Norsworthy PJ, Wahid FN, Al-Majali KM, Trembling PM, Mann CJ, Shoulders CC, Graf D, St Lezin E, Kurtz TW, Kren V, Pravenec M, Ibrahimi A, Abumrad NA, Stanton LW, Scott J (1999) Identification of Cd36 (Fat) as an insulin-resistance gene causing defective fatty acid and glucose metabolism in hypertensive rats. Nat Genet 21:76–83View ArticlePubMedGoogle Scholar
  2. Chon SH, Zhou YX, Dixon JL, Storch J (2007) Intestinal monoacylglycerol metabolism: developmental and nutritional regulation of monoacylglycerol lipase and monoacylglycerol acyltransferase. J Biol Chem 282:33346–33357View ArticlePubMedGoogle Scholar
  3. Dalen KT, Ulven SM, Bamberg K, Gustafsson JA, Nebb HI (2003) Expression of the insulin-responsive glucose transporter GLUT4 in adipocytes is dependent on liver X receptor alpha. J Biol Chem 278:48283–48291View ArticlePubMedGoogle Scholar
  4. Diraison F, Dusserre E, Vidal H, Sothier M, Beylot M (2002) Increased hepatic lipogenesis but decreased expression of lipogenic gene in adipose tissue in human obesity. Am J Physiol Endocrinol Metab 282:E46–E51PubMedGoogle Scholar
  5. Glassford J, Vigorito E, Soeiro I, Madureira PA, Zoumpoulidou G, Brosens JJ, Turner M, Lam EW (2005) Phosphatidylinositol 3-kinase is required for the transcriptional activation of cyclin D2 in BCR activated primary mouse B lymphocytes. Eur J Immunol 35:2748–2761View ArticlePubMedGoogle Scholar
  6. Hoare HL, Sullivan LC, Clements CS, Ely LK, Beddoe T, Henderson KN, Lin J, Reid HH, Brooks AG, Rossjohn J (2008) Subtle changes in peptide conformation profoundly affect recognition of the non-classical MHC class I molecule HLA-E by the CD94-NKG2 natural killer cell receptors. J Mol Biol 377:1297–1303View ArticlePubMedGoogle Scholar
  7. Kalra SP, Bagnasco M, Otukonyong EE, Dube MG, Kalra PS (2003) Rhythmic, reciprocal ghrelin and leptin signaling: new insight in the development of obesity. Regul Pept 111:1–11View ArticlePubMedGoogle Scholar
  8. Kanazawa A, Tsukada S, Sekine A, Tsunoda T, Takahashi A, Kashiwagi A, Tanaka Y, Babazono T, Matsuda M, Kaku K, Iwamoto Y, Kawamori R, Kikkawa R, Nakamura Y, Maeda S (2004) Association of the gene encoding wingless-type mammary tumor virus integration-site family member 5B (WNT5B) with type 2 diabetes. Am J Hum Genet 75:832–843View ArticlePubMedGoogle Scholar
  9. Kim JH, Stewart TP, Zhang W, Kim HY, Nishina PM, Naggert JK (2005) Type 2 diabetes mouse model TallyHo carries an obesity gene on chromosome 6 that exaggerates dietary obesity. Physiol Genomics 22:171–181View ArticlePubMedGoogle Scholar
  10. Koza RA, Nikonova L, Hogan J, Rim JS, Mendoza T, Faulk C, Skaf J, Kozak LP (2006) Changes in gene expression foreshadow diet-induced obesity in genetically identical mice. PLoS Genet 2:e81View ArticlePubMedGoogle Scholar
  11. Lawrence VJ, Kopelman PG (2004) Medical consequences of obesity. Clin Dermatol 22:296–302View ArticlePubMedGoogle Scholar
  12. Lelias JM, Adra CN, Wulf GM, Guillemot JC, Khagad M, Caput D, Lim B (1993) cDNA cloning of a human mRNA preferentially expressed in hematopoietic cells and with homology to a GDP-dissociation inhibitor for the rho GTP-binding proteins. Proc Natl Acad Sci USA 90:1479–1483View ArticlePubMedGoogle Scholar
  13. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402–408View ArticlePubMedGoogle Scholar
  14. Luong A, Hannah VC, Brown MS, Goldstein JL (2000) Molecular characterization of human acetyl-CoA synthetase, an enzyme regulated by sterol regulatory element-binding proteins. J Biol Chem 275:26458–26466View ArticlePubMedGoogle Scholar
  15. Metcalf D, Greenhalgh CJ, Viney E, Willson TA, Starr R, Nicola NA, Hilton DJ, Alexander WS (2000) Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405:1069–1073View ArticlePubMedGoogle Scholar
  16. Norstedt G, Palmiter R (1984) Secretory rhythm of growth hormone regulates sexual differentiation of mouse liver. Cell 36:805–812View ArticlePubMedGoogle Scholar
  17. Ortega FJ, Mayas D, Moreno-Navarrete JM, Catalán V, Gómez-Ambrosi J, Esteve E, Rodriguez-Hermosa JI, Ruiz B, Ricart W, Peral B, Fruhbeck G, Tinahones FJ, Fernández-Real JM (2009) The gene expression of the main lipogenic enzymes is downregulated in visceral adipose tissue of obese subjects. Obesity (Silver Spring). doi:10.1088/oby.2009.202
  18. Prestwich TC, Macdougald OA (2007) Wnt/beta-catenin signaling in adipogenesis and metabolism. Curr Opin Cell Biol 19:612–617View ArticlePubMedGoogle Scholar
  19. Prosniak M, Zborek A, Scott GS, Roy A, Phares TW, Koprowski H, Hooper DC (2003) Differential expression of growth factors at the cellular level in virus-infected brain. Proc Natl Acad Sci USA 100:6765–6770View ArticlePubMedGoogle Scholar
  20. Ramakrishna S, Kim IM, Petrovic V, Malin D, Wang IC, Kalin TV, Meliton L, Zhao YY, Ackerson T, Qin Y, Malik AB, Costa RH, Kalinichenko VV (2007) Myocardium defects and ventricular hypoplasia in mice homozygous null for the Forkhead Box M1 transcription factor. Dev Dyn 236:1000–1013View ArticlePubMedGoogle Scholar
  21. Rapp JP, Deng AY (1995) Detection and positional cloning of blood pressure quantitative trait loci: is it possible? Hypertension 25:1121–1128PubMedGoogle Scholar
  22. Reiner A, Yekutieli D, Benjamini Y (2003) Identifying differentially expressed genes using false discovery rate controlling procedures. Bioinformatics 19:368–375View ArticlePubMedGoogle Scholar
  23. Romao I, Roth J (2008) Genetic and environmental interactions in obesity and type 2 diabetes. J Am Diet Assoc 108:S24–S28View ArticlePubMedGoogle Scholar
  24. Saario SM, Laitinen JT (2007) Monoglyceride lipase as an enzyme hydrolyzing 2-arachidonoylglycerol. Chem Biodivers 4:1903–1913View ArticlePubMedGoogle Scholar
  25. Salpea KD, Gable DR, Cooper JA, Stephens JW, Hurel SJ, Ireland HA, Feher MD, Godsland IF, Humphries SE (2009) The effect of WNT5B IVS3C>G on the susceptibility to type 2 diabetes in UK Caucasian subjects. Nutr Metab Cardiovasc Dis 19(2):140–145View ArticlePubMedGoogle Scholar
  26. Sone H, Shimano H, Sakakura Y, Inoue N, Amemiya-Kudo M, Yahagi N, Osawa M, Suzuki H, Yokoo T, Takahashi A, Iida K, Toyoshima H, Iwama A, Yamada N (2002) Acetyl-coenzyme A synthetase is a lipogenic enzyme controlled by SREBP-1 and energy status. Am J Physiol Endocrinol Metab 282:E222–E230PubMedGoogle Scholar
  27. Speakman J, Hambly C, Mitchell S, Krol E (2007) Animal models of obesity. Obes Rev 8(1):55–61View ArticlePubMedGoogle Scholar
  28. Stylianou IM, Clinton M, Keightley PD, Pritchard C, Tymowska-Lalanne Z, Bunger L, Horvat S (2005) Microarray gene expression analysis of the Fob3b obesity QTL identifies positional candidate gene Sqle and perturbed cholesterol and glycolysis pathways. Physiol Genomics 20:224–232PubMedGoogle Scholar
  29. Tong L (2005) Acetyl-coenzyme A carboxylase: crucial metabolic enzyme and attractive target for drug discovery. Cell Mol Life Sci 62:1784–1803View ArticlePubMedGoogle Scholar
  30. Wilborn C, Beckham J, Campbell B, Harvey T, Galbreath M, La Bounty P, Nassar E, Wismann J, Kreider R (2005) Obesity: prevalence, theories, medical consequences, management, and research directions. J Int Soc Sports Nutr 2:4–31View ArticlePubMedGoogle Scholar
  31. Wolfinger RD, Gibson G, Wolfinger E, Bennett L, Hamadeh H, Bushel P, Afshari C, Paules RS (2001) Assessing gene significance from cDNA microarray expression data via mixed models. J Comput Biol 8:625–637View ArticlePubMedGoogle Scholar
  32. Yin L, Schwartzberg P, Scharton-Kersten TM, Staudt L, Lenardo M (1997) Immune responses in mice deficient in Ly-GDI, a lymphoid-specific regulator of Rho GTPases. Mol Immunol 34:481–491View ArticlePubMedGoogle Scholar

Copyright

Advertisement